aroA

Information for aroA, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 956876-957964 + CDS serC EG10946 3-phosphoserine aminotransferase 958035-959318 + CDS aroA EG10073 5-enolpyruvylshikimate-3-phosphate synthetase 959463-960251 + CDS ycaL EG13133 putative heat shock protein

Reported regulatory sites for aroA: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.263 957984-958004 ttaat CCCCACAGCCAGCCTGTGGGG ttttt - 0 - 0.796 957963-957984 cggtt AATGCCGAAATTTTGCTTAATC cccac - 0 -

Critical MAP values: p=0.01 4.80 p=0.05 3.45 p=0.1 2.95 p=0.2 2.42

Click here to go back