aroF

Information for aroF, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2736968-2738089 - CDS tyrA EG11039 chorismate mutase-T and prephenate dehydrogenase 2738100-2739170 - CDS aroF EG10078 3-deoxy-D-arabinoheptulosonate-7-phosphate synthase (DAHP synthetase; tyrosine repressible) 2739341-2739745 + CDS yfiL EG12446 orf; hypothetical protein

Reported regulatory sites for aroF: Genome coordinates Source Transcription factor Transcription factor annotation 2739240-2739261 DPInteract tyrR transcriptional regulation of aroF aroG tyrA and aromatic amino acid transport 2739263-2739284 DPInteract tyrR transcriptional regulation of aroF aroG tyrA and aromatic amino acid transport 2739315-2739336 DPInteract tyrR transcriptional regulation of aroF aroG tyrA and aromatic amino acid transport

Species with an ortholog: PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 5.215 2739317-2739334 R gggag TGTAAATTTATCTATACA gaggt tyrR 18 - 5.215 2739242-2739259 R aaata TGGATTGAAAACTTTACT ttatg tyrR 18 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.148 2739205-2739223 R ttacg TCATCCTCGCTGAGGATCA actat - 0 - 0.500 2739265-2739288 R taaat TGCCTGTGTAAATAAAAATGTACG aaata tyrR 20 - 0.500 2739176-2739199 R actat CGCAAACGAGCATAAACAGGATCG ccatc - 0 -

Critical MAP values: p=0.01 5.41 p=0.05 4.01 p=0.1 3.43 p=0.2 2.86

Click here to go back