aroG

Information for aroG, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 784160-784540 - CDS b0753 EG13663 putative homeobox protein 784856-785908 + CDS aroG EG10079 3-deoxy-D-arabinoheptulosonate-7-phosphate synthase (DAHP synthetase; phenylalanine repressible) 786066-786818 - CDS gpmA EG11699 phosphoglyceromutase 1

Reported regulatory sites for aroG: Genome coordinates Source Transcription factor Transcription factor annotation 784766-784787 DPInteract tyrR transcriptional regulation of aroF aroG tyrA and aromatic amino acid transport

Species with an ortholog: HI SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.228 784766-784787 ttcat AGTGTAAAACCCCGTTTACACA ttctg tyrR 22 - 2.399 784656-784678 agaat CTTGAAATAATTAACAAACAAAG gagtt - 0 - 1.834 784805-784827 atata GATTGGAAGTATTGCATTCACTA agata - 0 -

Critical MAP values: p=0.01 5.41 p=0.05 4.01 p=0.1 3.43 p=0.2 2.86

Click here to go back