aroK

Information for aroK, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 3515036-3516124 - CDS aroB EG10074 3-dehydroquinate synthase 3516181-3516903 - CDS aroK EG10081 shikimate kinase I 3517103-3518341 - CDS hofQ EG12113 putative transport portein

Reported regulatory sites for aroK: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.295 3517076-3517095 R agccg TAAAAGCGGTAATGTTTTTA cgctg - 0 - 4.295 3517012-3517031 R tagca TACAAGGAGTACCGATTTGA gagtt - 0 - 0.650 3517032-3517055 R atcta TTTGACGCGCGCAGGTATTTAGCA tacaa - 0 -

Critical MAP values: p=0.01 7.30 p=0.05 6.05 p=0.1 5.26 p=0.2 4.60

Click here to go back