aroP

Information for aroP, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 119281-120135 + CDS ampE EG10042 regulates ampC 120178-121551 - CDS aroP EG10084 aromatic amino acid transport protein 122092-122856 + CDS pdhR EG11088 transcriptional regulator for pyruvate dehydrogenase complex

Reported regulatory sites for aroP: Genome coordinates Source Transcription factor Transcription factor annotation 121597-121618 DPInteract tyrR transcriptional regulation of aroF aroG tyrA and aromatic amino acid transport 121620-121641 DPInteract tyrR transcriptional regulation of aroF aroG tyrA and aromatic amino acid transport

Species with an ortholog: PA ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.692 121622-121639 R tttga TGTAAACAAATTAATACA acaaa tyrR 18 - 2.833 122006-122026 R cgcta AAGTAACAAAGTATTCACCTT atgtc - 0 - 2.394 121863-121886 R agttt TTTAACGATTATTAAACTATAAAA atccg - 0 - 2.394 121811-121834 R accaa TTTTGTGATTTTTAATTCAATTAA aacga - 0 -

Critical MAP values: p=0.01 6.66 p=0.05 5.31 p=0.1 4.59 p=0.2 3.95

Click here to go back