artJ

Information for artJ, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 897741-898868 + CDS ybjF EG13427 putative enzyme 899067-899798 - CDS artJ EG11628 arginine 3rd transport system periplasmic binding protein 900089-900757 - CDS artM EG11627 arginine 3rd transport system permease protein

Reported regulatory sites for artJ: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 5.148 899901-899919 R ccgtc TTTTTTATTTCATTTAAAT tattt - 0 - 5.148 899873-899891 R taatc ATGTTTATTGCATATAAAT tcact - 0 - 4.258 899844-899864 R cttga TGGCATTGTTATCCCATGCCG cagac - 0 - 4.023 899922-899944 R gaaga CGGACAACCCACTAAGTTGTCCG tcttt - 0 -

Critical MAP values: p=0.01 7.30 p=0.05 6.05 p=0.1 5.26 p=0.2 4.60

Click here to go back