artP

Information for artP, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 901480-902211 - CDS artI EG11625 arginine 3rd transport system periplasmic binding protein 902229-902957 - CDS artP EG11624 ATP-binding component of 3rd arginine transport system 903175-903690 - CDS ybjP EG13685 putative enzyme

Reported regulatory sites for artP: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 5.347 903016-903038 R ttaaa GCAGAAATATTGCATAATTATTC tgtca - 0 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.483 903134-903156 R caata AACCCCGTAAATTGTCCGGCATT tcgtg - 0 - 1.078 902978-902993 R tcgac CTCAATAGCTATCAGA ctgcc - 0 -

Critical MAP values: p=0.01 6.03 p=0.05 4.63 p=0.1 3.98 p=0.2 3.37

Click here to go back