asnB

Information for asnB, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 696280-696356 - tRNA metT EG30058 Methionine tRNAm; duplicate gene 696736-698400 - CDS asnB EG10092 asparagine synthetase B 698797-699549 - CDS nagD EG10634 N-acetylglucosamine metabolism

Reported regulatory sites for asnB: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.836 698558-698580 R cgcta AAAATTATCGATTCATCAATAAA tatat - 0 - 1.836 698516-698538 R agacc TTTTTTCACCAATCGACAATCAC catta - 0 - 0.796 698651-698674 R aggcc GGATAAGGCGTTCACGCCGCATCC ggcat - 0 REP61a (24) 0.743 698772-698789 R agcaa CCACGTCTGCGGACGTGG ttggc - 0 -

Critical MAP values: p=0.01 5.41 p=0.05 4.01 p=0.1 3.43 p=0.2 2.86

Click here to go back