asnC

Information for asnC, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 3923640-3924083 - CDS mioC EG11199 initiation of chromosome replication 3924173-3924631 - CDS asnC EG10093 regulator for asnA; asnC and gidA 3924783-3925775 + CDS asnA EG10091 asparagine synthetase A

Reported regulatory sites for asnC: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.779 3924743-3924762 R gtcct GTTGCTTATGATTAAGCAAC aaaaa - 0 - 2.118 3924706-3924722 R tgcaa TAATCATTCAATAAAAA gccta - 0 - 2.118 3924678-3924694 R ctcac TTTTGATTCATTAAAAA agaag - 0 - 0.527 3924636-3924657 R aatga ATCATCAATCCGCATAAGAAAA tccta - 0 -

Critical MAP values: p=0.01 5.41 p=0.05 4.01 p=0.1 3.43 p=0.2 2.86

Click here to go back