asnS

Information for asnS, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 985117-986205 - CDS ompF EG10671 outer membrane protein 1a (Ia;b;F) 986808-988208 - CDS asnS EG10094 asparagine tRNA synthetase 988377-989579 - CDS pncB EG10742 nicotinate phosphoribosyltransferase

Reported regulatory sites for asnS: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.944 988257-988278 R caggt AACATAGGTATCCCCCCATTTA cgggt - 0 - 1.928 988223-988240 R gtgtt TATTTTTTCCGACTATTA acaga - 0 - 1.679 988285-988308 R tgcga ATTCTGCTTGTCTGATTGCAGATG ccagg - 0 -

Critical MAP values: p=0.01 5.41 p=0.05 4.01 p=0.1 3.43 p=0.2 2.86

Click here to go back