aspC

Information for aspC, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 982873-983520 + CDS ycbL EG13704 orf; hypothetical protein 983742-984932 - CDS aspC EG10096 aspartate aminotransferase 985117-986205 - CDS ompF EG10671 outer membrane protein 1a (Ia;b;F)

Reported regulatory sites for aspC: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.553 985066-985089 R ccgaa AAAACAGGACTTTGGTCCTGTTTT tttta - 0 - 2.027 984953-984969 R tgata GCGGACTTCCCTTCTGT aacca - 0 - 1.996 985014-985032 R cttgc AAAAACAGCCTGCGTTTTC atcag - 0 -

Critical MAP values: p=0.01 4.80 p=0.05 3.45 p=0.1 2.95 p=0.2 2.42

Click here to go back