aspS

Information for aspS, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1946204-1946656 - CDS ntpA EG11138 dATP pyrophosphohydrolase 1946774-1948546 - CDS aspS EG10097 aspartate tRNA synthetase 1948823-1949422 + CDS yecD EG12378 orf; hypothetical protein

Reported regulatory sites for aspS: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.240 1948774-1948790 R acgac AAATTTTGTTAATTTTT atgag - 0 - 2.131 1948636-1948652 R ccagt ATAATAGCCGCCTTTTT tcatt - 0 - 1.439 1948656-1948678 R caggc TCTTACGGTGCGGCAGAATTTCC agtat - 0 - 1.439 1948593-1948615 R ataca GCTAACGCTGCGACTTGGTCACC tgcgc - 0 -

Critical MAP values: p=0.01 4.80 p=0.05 3.45 p=0.1 2.95 p=0.2 2.42

Click here to go back