asr

Information for asr, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1667723-1668976 + CDS ynfM EG12951 putative transport protein 1669373-1669708 + CDS asr EG12149 acid shock protein 1669984-1670805 + CDS b1598 EG13925 orf; hypothetical protein

Reported regulatory sites for asr: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.967 1669288-1669308 tacat ATCGTTACACGCTGAAACCAA ccact - 0 - 1.938 1669258-1669280 ttatc AACGCTGTAATTTATTCAGCGTT tgtac - 0 - 1.938 1669334-1669356 ttccc AGGGATATAGTTATTTCAACGGC cccgc - 0 - 1.917 1669072-1669088 agcca ATTCCCGCAGCGCGTCT agcgt - 0 - 1.917 1669354-1669370 tcaac GGCCCCGCAGTGGGGTT aaatg - 0 -

Critical MAP values: p=0.01 7.30 p=0.05 6.05 p=0.1 5.26 p=0.2 4.60

Click here to go back