atoD

Information for atoD, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2319886-2321271 + CDS atoC EG11668 response regulator of ato; ornithine decarboxylase antizyme (sensor ATOS) 2321467-2322129 + CDS atoD EG11669 acetyl-CoA:acetoacetyl-CoA transferase alpha subunit 2322129-2322779 + CDS atoA EG11670 acetyl-CoA:acetoacetyl-CoA transferase beta subunit

Reported regulatory sites for atoD: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI PA SP EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.305 2321375-2321390 caatt AGTTAAATAACTAAAT ccaat - 0 - 1.005 2321285-2321302 cttgc TATGCAGAAATTTGCACA gtgcg - 0 - 1.005 2321304-2321321 cacag TGCGCAATTTTCTGCATA gccgc - 0 - 0.587 2321415-2321434 actcc CCTTGCTATTGCCTGACTGT accca - 0 -

Critical MAP values: p=0.01 3.02 p=0.05 2.31 p=0.1 1.98 p=0.2 1.61

Click here to go back