atpF

Information for atpF, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 3917498-3918031 - CDS atpH EG10105 membrane-bound ATP synthase; F1 sector; delta-subunit 3918046-3918516 - CDS atpF EG10103 membrane-bound ATP synthase; F0 sector; subunit b 3918578-3918817 - CDS atpE EG10102 membrane-bound ATP synthase; F0 sector; subunit c

Reported regulatory sites for atpF: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.217 3918537-3918560 R ttatt TAAAGAGCAATATCAGAACGTTAA ctaaa - 0 - 1.517 3918517-3918534 R taact AAATAGAGGCATTGTGCT gtgaa - 0 -

Critical MAP values: p=0.01 4.80 p=0.05 3.45 p=0.1 2.95 p=0.2 2.42

Click here to go back