atpG

Information for atpG, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 3913621-3915003 - CDS atpD EG10101 membrane-bound ATP synthase; F1 sector; beta-subunit 3915030-3915893 - CDS atpG EG10104 membrane-bound ATP synthase; F1 sector; gamma-subunit 3915944-3917485 - CDS atpA EG10098 membrane-bound ATP synthase; F1 sector; alpha-subunit

Reported regulatory sites for atpG: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.924 3915926-3915945 R ctggt AACGTCTGGCGGCTTGCCTT agggc - 0 - 4.924 3915906-3915925 R gcctt AGGGCAGGCCGCAAGGCATT gagga - 0 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Critical MAP values: p=0.01 4.80 p=0.05 3.45 p=0.1 2.95 p=0.2 2.42

Click here to go back