atpI

Information for atpI, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 3918864-3919679 - CDS atpB EG10099 membrane-bound ATP synthase; F0 sector; subunit a 3919688-3920080 - CDS atpI EG10106 membrane-bound ATP synthase; dispensable protein; affects expression of atpB 3920685-3921308 - CDS gidB EG10376 glucose-inhibited division; chromosome replication?

Reported regulatory sites for atpI: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 7.477 3920208-3920230 R cactg GAAAAATATTTAAACATTTATTC acctt - 0 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.960 3920404-3920424 R attta TTAAAACAGTATCTGTTTTTA gactg - 0 - 4.514 3920122-3920138 R gcttg ACTCTAAGCCTTAAAGA aagtt - 0 -

Critical MAP values: p=0.01 7.30 p=0.05 6.05 p=0.1 5.26 p=0.2 4.60

Click here to go back