b0005

Information for b0005, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 3734-5020 + CDS thrC EG11000 threonine synthase 5234-5530 + CDS b0005 EG14384 orf; hypothetical protein 5683-6459 - CDS yaaA EG10011 orf; hypothetical protein

Reported regulatory sites for b0005: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 0.706 5069-5090 gcccg GCTTTTTTATGAAGAAATTATG gagaa - 0 - 0.706 5113-5134 aaaag GAGAAATTCTCAATAAATGCGG taact - 0 -

Critical MAP values: p=0.01 7.59 p=0.05 6.45 p=0.1 5.76 p=0.2 5.04

Click here to go back