b0235

Information for b0235, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 252709-253161 + CDS yafP EG13153 orf; hypothetical protein 253467-253733 + CDS b0235 EG14368 orf; hypothetical protein 253702-254202 + CDS prfH EG11496 probable peptide chain release factor

Reported regulatory sites for b0235: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.901 253231-253249 aagga GGTAAATCATGACAAATCC tttat - 0 - 1.901 253305-253323 gccct GGATTCGTCTGCCATTTCC tgatt - 0 - 1.590 253271-253287 tgcag ACCTTTCCAGGATTAAT tcttt - 0 - 0.052 253355-253378 taatt CGAGTTGCAGGAAGGCGACAAGCG agtga - 0 IRU3 (24)

Critical MAP values: p=0.01 6.82 p=0.05 5.66 p=0.1 5.03 p=0.2 4.36

Click here to go back