b0379

Information for b0379, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 397096-398190 + CDS yaiW EG13608 orf; hypothetical protein 398249-398557 - CDS b0379 EG14279 orf; hypothetical protein 398685-399029 + CDS b0380 EG14280 orf; hypothetical protein

Reported regulatory sites for b0379: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.557 398635-398658 R tcaat TTACCATGATTCTGATATTGACAA tctaa - 0 - 3.782 398610-398628 R ctaaa TGACCTGTCAGACTTGCCA taagc - 0 - 1.360 398585-398605 R ataag CCGCTGGTATCACACCAGAAG agaag - 0 -

Critical MAP values: p=0.01 7.59 p=0.05 6.45 p=0.1 5.76 p=0.2 5.04

Click here to go back