b0380

Information for b0380, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 398249-398557 - CDS b0379 EG14279 orf; hypothetical protein 398685-399029 + CDS b0380 EG14280 orf; hypothetical protein 399053-400147 - CDS ddlA EG10213 D-alanine-D-alanine ligase A

Reported regulatory sites for b0380: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.773 398628-398650 aggtc ATTTAGATTGTCAATATCAGAAT catgg - 0 - 1.397 398611-398627 cttat GGCAAGTCTGACAGGTC attta - 0 - 1.169 398586-398604 ttctc TTCTGGTGTGATACCAGCG gctta - 0 - 1.169 398664-398682 attga TGTTGGGAATATTCCCGAA gcgtg - 0 -

Critical MAP values: p=0.01 7.59 p=0.05 6.45 p=0.1 5.76 p=0.2 5.04

Click here to go back