b0502

Information for b0502, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 528163-528354 + CDS b0501 - orf; hypothetical protein 528869-529276 - CDS b0502 EG14285 orf; hypothetical protein 529356-530450 - CDS ybbB EG11768 putative capsule anchoring protein

Reported regulatory sites for b0502: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: SP EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.827 529322-529341 R tattt GTATTAGTCGCGACTTGATC tgaca - 0 - 2.794 529309-529329 R tcgcg ACTTGATCTGACACATGGCCT tgaaa - 0 - 2.790 529286-529306 R ccttg AAAGGTTGAGAGTTACCGGTT ttgat - 0 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Critical MAP values: p=0.01 3.34 p=0.05 2.41 p=0.1 2.01 p=0.2 1.55

Click here to go back