b0539

Information for b0539, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 564038-565201 - CDS intD EG10507 prophage DLP12 integrase 565321-565584 - CDS b0539 EG12349 putative exonuclease (EC 3.1.11.3) similar to lambda 565195-565755 + CDS b0538 - putative sensory transduction regulator

Reported regulatory sites for b0539: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 0.690 565703-565718 R gcgtc AGCCAGCGCATTGGCC cgcat - 0 - 0.587 565622-565639 R aagac TCTGCATCCGGATACAGG ccacg - 0 - 0.582 565750-565769 R attcg CGCTGTCATACAGGTCAGTT catcg - 0 -

Critical MAP values: p=0.01 7.59 p=0.05 6.45 p=0.1 5.76 p=0.2 5.04

Click here to go back