b0753

Information for b0753, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 783105-784046 - CDS ybgR EG13662 putative transport system permease protein 784160-784540 - CDS b0753 EG13663 putative homeobox protein 784856-785908 + CDS aroG EG10079 3-deoxy-D-arabinoheptulosonate-7-phosphate synthase (DAHP synthetase; phenylalanine repressible)

Reported regulatory sites for b0753: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 7.458 784766-784787 R cagaa TGTGTAAACGGGGTTTTACACT atgaa tyrR 22 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 5.928 784565-784586 R tgcac TGTTGGAAGAGGTTATCCGACA taacg - 0 - 3.511 784682-784700 R ctctc CTACAATTTCTAACTGTAA ctcct - 0 -

Critical MAP values: p=0.01 7.59 p=0.05 6.45 p=0.1 5.76 p=0.2 5.04

Click here to go back