b0805

Information for b0805, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 837753-838466 - CDS ybiX EG13316 putative enzyme 838472-840754 - CDS b0805 EG13317 putative outer membrane receptor for iron transport 841019-841423 - CDS ybiM EG13318 orf; hypothetical protein

Reported regulatory sites for b0805: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 0.318 840863-840882 R aagtg ATAATGCTTATCAAAATTAT tatca - 0 - 0.312 840981-841000 R actgc ATTCGCCTCTGGATGCAGTT ttcgt - 0 -

Critical MAP values: p=0.01 4.78 p=0.05 3.24 p=0.1 2.72 p=0.2 2.16

Click here to go back