b0817

Information for b0817, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 851894-852163 + CDS b0816 - orf; hypothetical protein 852406-852873 + CDS b0817 EG13322 putative toxin 852870-853988 + CDS ybiR EG13323 orf; hypothetical protein

Reported regulatory sites for b0817: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 6.026 852279-852301 tacag ATATAGCACAGGCTATATTATAT agcta - 0 - 5.592 852310-852328 tattg CTAAAACGTTAATTTTTTG tacct - 0 - 4.403 852187-852210 atgac TAAACACGCGCATACACCTCTTGA actca - 0 -

Critical MAP values: p=0.01 7.59 p=0.05 6.45 p=0.1 5.76 p=0.2 5.04

Click here to go back