b0822

Information for b0822, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 857019-858284 - CDS ybiU EG13326 orf; hypothetical protein 858436-859251 - CDS b0822 EG13327 orf; hypothetical protein 859397-861829 - CDS ybiW EG13328 putative formate acetyltransferase

Reported regulatory sites for b0822: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.917 859284-859301 R gcgtc ACATTGTTATTACACTGT tacgg - 0 - 4.580 859315-859336 R atcct TACTTTCATTCGAAATATAATT tgtgc - 0 - 0.000 859369-859385 R cggcc CGGCGGCGTCGTCGCCG ggcta - 0 - -

Critical MAP values: p=0.01 7.59 p=0.05 6.45 p=0.1 5.76 p=0.2 5.04

Click here to go back