b0836

Information for b0836, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 875933-877258 - CDS yliG EG13478 orf; hypothetical protein 877471-877854 + CDS b0836 EG13479 putative receptor 877965-879080 + CDS yliI EG13480 putative dehydrogenase

Reported regulatory sites for b0836: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.028 877300-877321 caggg ATTCTACAGAGTTCTGGATAAA atttg - 0 - 2.161 877321-877337 gataa AATTTGTATCGCAATCT cattc - 0 - 1.536 877259-877278 ctcat AGCTTAAAAAATATTCAGTT acagg - 0 - 1.536 877360-877379 gaagg AAATGTAAATTTTGTTAATT cggcg - 0 -

Critical MAP values: p=0.01 7.59 p=0.05 6.45 p=0.1 5.76 p=0.2 5.04

Click here to go back