b0847

Information for b0847, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 886646-887182 + CDS b0846 EG13680 putative DEOR-type transcriptional regulator 887357-889042 - CDS b0847 EG13681 putative transport protein 889312-889689 + CDS ybjM EG13682 orf; hypothetical protein

Reported regulatory sites for b0847: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.327 889082-889098 R aacat TATCGTAAATTACCATT tcttt - 0 - 1.586 889164-889185 R ctaat GTGATTACACTAGTAAAATATA ttgtt - 0 - 1.586 889054-889075 R ctttc AACAGCTTACTAGTAAACAAGA agtta - 0 - 1.388 889230-889253 R cagta AGATAAAGCCGCTTCGCATTCCAT gctaa - 0 -

Critical MAP values: p=0.01 6.03 p=0.05 4.63 p=0.1 3.98 p=0.2 3.37

Click here to go back