b0866

Information for b0866, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 903175-903690 - CDS ybjP EG13685 putative enzyme 903816-904139 + CDS b0866 EG13686 orf; hypothetical protein 904136-904966 + CDS b0867 EG13687 putative regulator

Reported regulatory sites for b0866: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC VC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 6.158 903741-903763 taatg ATATCCTTTCAATAATAGCGTAT cagtc - 0 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.823 903694-903712 ataat GATTTCCTTATAAGCGATC gctct - 0 - 2.235 903774-903795 tgata ATGCTTTTGAGATCGAAGGCTT agcaa - 0 -

Critical MAP values: p=0.01 6.82 p=0.05 5.66 p=0.1 5.03 p=0.2 4.36

Click here to go back