b0868

Information for b0868, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 904136-904966 + CDS b0867 EG13687 putative regulator 904963-906012 - CDS b0868 EG13688 putative nucleotide di-P-sugar epimerase or dehydratase 906075-907535 - CDS ybjT EG13689 putative dTDP-glucose enzyme

Reported regulatory sites for b0868: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA SP ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.723 906050-906071 R aatcg ACAAAACCTGCGTTATTCTTTC atgtt - 0 - 2.723 906032-906047 R ttcat GTTTCCCATTGCATCA tgggg - 0 -

Critical MAP values: p=0.01 6.03 p=0.05 4.63 p=0.1 3.98 p=0.2 3.37

Click here to go back