b0878

Information for b0878, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 917351-918343 - CDS ybjX EG13693 putative enzyme 918431-919573 + CDS b0878 EG13694 putative membrane protein 919570-921516 + CDS ybjZ EG13695 putative ATP-binding component of a transport system

Reported regulatory sites for b0878: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA SP ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.818 918349-918372 tgcgt ATCTTAACCAAACATCAATAGTGT gatta - 0 - 1.818 918395-918418 ttagg GTTTTGTTGATATTTCGTTGAAGT taatg - 0 -

Critical MAP values: p=0.01 6.03 p=0.05 4.63 p=0.1 3.98 p=0.2 3.37

Click here to go back