b0919

Information for b0919, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 970075-970821 + CDS kdsB EG10519 CTP:CMP-3-deoxy-D-manno-octulosonate transferase 970975-971868 + CDS b0919 EG13702 orf; hypothetical protein 971845-972624 - CDS ycbC EG12166 orf; hypothetical protein

Reported regulatory sites for b0919: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.865 970859-970876 aggag TGTCGTACCGTTACGATT ttcct - 0 - 3.811 970902-970923 acaat TGATCTCATTCAGGTGACATCT tttat - 0 - 3.665 970942-970961 tcatt ATGAAAGCAGTAGCTTTTAT gaggg - 0 -

Critical MAP values: p=0.01 7.30 p=0.05 6.05 p=0.1 5.26 p=0.2 4.60

Click here to go back