b0967

Information for b0967, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1027627-1027995 - CDS yccV EG13724 orf; hypothetical protein 1028002-1029105 - CDS b0967 EG13725 putative oxidoreductase 1029287-1029565 + CDS b0968 EG13726 orf; hypothetical protein

Reported regulatory sites for b0967: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.962 1029143-1029165 R ccaaa GGGCGCGAAAAATCATTACTTCG tcgcc - 0 - 4.103 1029122-1029143 R acttc GTCGCCATCCGTGGGTCTTTTC cgggg - 0 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 0.650 1029259-1029282 R ttgct GCTCTCCTTATCCTTAATGGACGC gttgc - 0 - 0.650 1029204-1029227 R caatg ACGCCCATTTCTTTGCATCGACAG aaaag - 0 -

Critical MAP values: p=0.01 5.41 p=0.05 4.01 p=0.1 3.43 p=0.2 2.86

Click here to go back