b0968

Information for b0968, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1028002-1029105 - CDS b0967 EG13725 putative oxidoreductase 1029287-1029565 + CDS b0968 EG13726 orf; hypothetical protein 1029562-1029948 - CDS yccK EG12876 putative sulfite reductase (EC 1.8.-.-)

Reported regulatory sites for b0968: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.246 1029139-1029161 ggatg GCGACGAAGTAATGATTTTTCGC gccct - 0 - 0.369 1029183-1029199 taaac GTACACTCATAATTTAC ttttc - 0 -

Critical MAP values: p=0.01 7.30 p=0.05 6.05 p=0.1 5.26 p=0.2 4.60

Click here to go back