b1045

Information for b1045, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1104637-1104948 + CDS b1044 EG13873 orf; hypothetical protein 1105043-1105576 + CDS b1045 EG13874 putative polyprotein 1105518-1106999 + CDS ymdC EG13875 putative synthase

Reported regulatory sites for b1045: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.158 1104962-1104985 acaac TCACGTTGCTGAGCAGAAAAATGC gattt - 0 - 1.111 1104998-1105014 ccaaa AAGCCTGCTGTACACTT aagaa - 0 -

Critical MAP values: p=0.01 6.82 p=0.05 5.66 p=0.1 5.03 p=0.2 4.36

Click here to go back