b1057

Information for b1057, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1117124-1117699 - CDS yceI EG11820 orf; hypothetical protein 1117703-1118269 - CDS b1057 EG12659 putative cytochrome 1118530-1118670 - CDS yceO EG14334 orf; hypothetical protein

Reported regulatory sites for b1057: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.120 1118364-1118384 R attat TAATTCAAAATTATTGAAATA aaaat - 0 - 4.120 1118343-1118363 R aaata AAAATAAATATCATTCAATTT gttat - 0 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.363 1118469-1118488 R tccct TTCATTTAGCGTGAAAAATT gaatg - 0 - 0.973 1118499-1118515 R ctgac ATAAACTGACAAATATT taatc - 0 -

Critical MAP values: p=0.01 5.41 p=0.05 4.01 p=0.1 3.43 p=0.2 2.86

Click here to go back