b1085

Information for b1085, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1140405-1143590 - CDS rne EG10859 RNase E; membrane attachment; mRNA turnover; maturation 5S RNA 1143671-1144045 + CDS b1085 - orf; hypothetical protein 1144163-1145122 + CDS yceC EG11118 orf; hypothetical protein

Reported regulatory sites for b1085: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 5.318 1143594-1143616 atcgt AACTTACTCATTATTCTTACATT gacga - 0 - 3.996 1143630-1143652 agctg CGGGCAAAGTAACGCCTTTCCGG gtgtg - 0 - 0.334 1143653-1143670 tccgg GTGTGAACCGATGGCCTC gtgtc - 0 -

Critical MAP values: p=0.01 7.59 p=0.05 6.45 p=0.1 5.76 p=0.2 5.04

Click here to go back