b1180

Information for b1180, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1226904-1227230 + CDS ycgL EG13893 orf; hypothetical protein 1227302-1227961 + CDS b1180 EG13894 putative isomerase 1228023-1228499 + CDS ycgN EG13895 orf; hypothetical protein

Reported regulatory sites for b1180: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.213 1227233-1227254 taacc GATATCCGGCGGTGGCATTATC tttgt - 0 - 0.851 1227275-1227297 tttca TATCCACGATAAGGTGAGGGGAA cgtta - 0 -

Critical MAP values: p=0.01 5.41 p=0.05 4.01 p=0.1 3.43 p=0.2 2.86

Click here to go back