b1191

Information for b1191, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1238102-1239172 + CDS dadX EG11408 alanine racemase 2; catabolic 1239558-1241168 - CDS b1191 EG13896 orf; hypothetical protein 1241389-1242303 - CDS b1192 EG13898 orf; hypothetical protein

Reported regulatory sites for b1191: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA SP ST EC VC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.767 1241189-1241212 R ttctt CCCGTCTTGGCATTCCTATTCTGG ttatt - 0 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.073 1241260-1241282 R ccaca ACAATAATTAGCCTTTTCATCTT aggat - 0 - 2.447 1241354-1241372 R ttcag GGCTAAGTAAAACGCTGTC tctgc - 0 - 2.447 1241222-1241240 R tcacc AGCAGTATATTACTTAGTT cattt - 0 -

Critical MAP values: p=0.01 5.40 p=0.05 4.29 p=0.1 3.77 p=0.2 3.19

Click here to go back