b1284

Information for b1284, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1341134-1341352 - CDS osmB EG10679 osmotically inducible lipoprotein 1341621-1342370 - CDS b1284 EG13905 putative DEOR-type transcriptional regulator 1342781-1344766 - CDS yciR EG13415 orf; hypothetical protein

Reported regulatory sites for b1284: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.240 1342574-1342597 R aacgt ATTGATATTGTGTTAGATATCCTT gtggc - 0 - 1.265 1342551-1342567 R tggca GGCGATTACCACTCTGC gatcc - 0 - 0.596 1342390-1342410 R cagta TTTTTTTATTAAGTATTATAA cgtta - 0 -

Critical MAP values: p=0.01 7.59 p=0.05 6.45 p=0.1 5.76 p=0.2 5.04

Click here to go back