b1342

Information for b1342, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1404587-1405879 - CDS b1341 EG13355 orf; hypothetical protein 1406074-1407057 + CDS b1342 EG13356 orf; hypothetical protein 1407535-1408908 + CDS dbpA EG10210 ATP-dependent RNA helicase

Reported regulatory sites for b1342: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.192 1405891-1405913 agata ATTCTGATAATGATAGACGCTAT ttaac - 0 - 1.192 1406051-1406073 aaaat AATGCGTTGATGATGGAGGCACT gtgga - 0 - 0.493 1406017-1406034 gatgt TGCGTAACAGGGCCAGAA ggcta - 0 - 0.168 1405961-1405983 tttgt ATTCAATTTAGACAGAATTTTAT taatc - 0 -

Critical MAP values: p=0.01 6.66 p=0.05 5.31 p=0.1 4.59 p=0.2 3.95

Click here to go back