b1377

Information for b1377, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1433209-1433715 - CDS ynaF EG12674 putative filament protein 1433784-1434917 - CDS b1377 EG13375 putative outer membrane protein 1435284-1438808 - CDS ydbK EG13183 putative oxidoreductase; Fe-S subunit

Reported regulatory sites for b1377: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.680 1435101-1435122 R tagca AATTAAAAGTATAATTTTTATT ttgta - 0 - 2.380 1435247-1435264 R gatta TCCAATTCTAAAAAAAAA gcccg - 0 - 1.974 1435075-1435098 R atttt GTATGTATTATCTTCGATACATTC accag - 0 -

Critical MAP values: p=0.01 7.30 p=0.05 6.05 p=0.1 5.26 p=0.2 4.60

Click here to go back