b1408

Information for b1408, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1473162-1475474 + CDS ydbD EG11310 orf; hypothetical protein 1475639-1476250 + CDS b1408 EG13748 probable enzyme 1476250-1477146 + CDS b1409 EG13749 putative phosphatidate cytidiltransferase

Reported regulatory sites for b1408: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 0.603 1475489-1475508 taatg TTTTTTAACTATCTGATTAA ttggg - 0 -

Critical MAP values: p=0.01 4.78 p=0.05 3.24 p=0.1 2.72 p=0.2 2.16

Click here to go back