b1428

Information for b1428, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1496962-1497501 + CDS rimL EG10853 acetylation of N-terminal serine of 30S ribosomal subunit protein L7; acetyl transferase 1497493-1498473 - CDS b1428 EG13754 orf; hypothetical protein 1498597-1499589 + CDS tehA EG11883 tellurite resistance

Reported regulatory sites for b1428: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 7.257 1498548-1498570 R tttat AAAGTATATTTGAAATGCATTTT atgga - 0 - 6.593 1498563-1498580 R ttttg TTTAATTTATAAAGTATA tttga - 0 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.047 1498576-1498592 R tcttc TTACTCATTTTGTTTAA tttat - 0 -

Critical MAP values: p=0.01 7.59 p=0.05 6.45 p=0.1 5.76 p=0.2 5.04

Click here to go back