b1431

Information for b1431, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1499586-1500179 + CDS tehB EG11884 tellurite resistance 1500481-1501149 + CDS b1431 EG13755 orf; hypothetical protein 1501681-1502889 + CDS b1432 EG13756 putative virulence protein

Reported regulatory sites for b1431: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.538 1500311-1500326 taact TACTGAAATTTAAGTA ctgat - 0 - - 0.646 1500386-1500409 ctgaa AAATTTATTTTCACCAACACTTTT tttgc - 0 - 0.254 1500417-1500438 tgcca CAACACGAAGCGGCGCTTTTTG ctata - 0 -

Critical MAP values: p=0.01 7.59 p=0.05 6.45 p=0.1 5.76 p=0.2 5.04

Click here to go back