b1436

Information for b1436, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1504763-1506766 + CDS ydcP EG13759 putative collagenase 1506858-1507088 - CDS b1436 EG14300 orf; hypothetical protein 1507274-1507471 - CDS b1437 - orf; hypothetical protein

Reported regulatory sites for b1436: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.605 1507143-1507164 R tgcgc TAATTTGCAAAACTGAATAATA acctc - 0 - 1.975 1507116-1507135 R ctcaa GAAACGATCGGCATCATAGC ggcaa - 0 - 1.488 1507261-1507276 R caaag TAAACATTAGTGTTTA cctcc - 0 -

Critical MAP values: p=0.01 7.59 p=0.05 6.45 p=0.1 5.76 p=0.2 5.04

Click here to go back