b1439

Information for b1439, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1507511-1507948 + CDS b1438 EG13760 orf; hypothetical protein 1508027-1509433 + CDS b1439 EG13761 multi modular; putative transcriptional regulator; also putative ATP-binding component of a transport system 1509678-1510823 + CDS b1440 EG13762 putative transport protein

Reported regulatory sites for b1439: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.192 1507964-1507983 cgaaa AGTTGTCATTTTTAACAACT gatat - 0 - 0.020 1507989-1508012 gatat AGACTGCCGAATCATCTGCACATA attac - 0 -

Critical MAP values: p=0.01 6.03 p=0.05 4.63 p=0.1 3.98 p=0.2 3.37

Click here to go back