b1448

Information for b1448, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1515906-1516355 - CDS b1447 EG13769 orf; hypothetical protein 1516352-1516870 - CDS b1448 EG13770 putative resistance protein 1516958-1518088 + CDS yncB EG13772 putative oxidoreductase

Reported regulatory sites for b1448: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.312 1516896-1516914 R tttcg ATAGTATTGATAACATCAT catca - 0 - 0.780 1516932-1516955 R cacgc AATAATTTCATCGAGGAATCCGTT gcttc - 0 -

Critical MAP values: p=0.01 6.82 p=0.05 5.66 p=0.1 5.03 p=0.2 4.36

Click here to go back