b1452

Information for b1452, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1518987-1521089 - CDS b1451 EG13774 putative outer membrane receptor for iron transport 1521331-1522392 + CDS b1452 EG13775 putative receptor 1522505-1524055 - CDS ansP EG13776 L-asparagine permease

Reported regulatory sites for b1452: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.139 1521228-1521243 gagaa AATAATGATTACCATT cccat - 0 - 3.206 1521163-1521184 aacgg CACAATACGTTAAGTAATTGAG aaaat - 0 - 1.379 1521245-1521261 cattc CCATTTATAACAAGAGC gtaac - 0 -

Critical MAP values: p=0.01 7.59 p=0.05 6.45 p=0.1 5.76 p=0.2 5.04

Click here to go back